| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.213164 |
| Chromosome: | chromosome 9 |
| Location: | 4052658 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g393321 | CSR12 | (1 of 6) 2.8.2.33 - N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase / GalNAc4S-6ST; Carbohydrate sulfotransferase-related 12 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACTGAGAACTGACCCAGGGATCCCACTGA |
| Internal bar code: | CCATCCTATACCCCAATTCTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 783 |
| LEAP-Seq percent confirming: | 99.4719 |
| LEAP-Seq n confirming: | 3202 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCCGTGAACTGTAACTGGT |
| Suggested primer 2: | GTGTTGAGGTGTGTGTTGCC |