Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.213187 |
Chromosome: | chromosome 6 |
Location: | 1567474 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g260400 | FAP287 | (1 of 1) PF13881 - Ubiquitin-2 like Rad60 SUMO-like (Rad60-SLD_2); Ubiquitin-like Flagellar Associated Protein | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATGGAGGTCTAAGAAGGGAAGGTCCAAA |
Internal bar code: | TAGGTGTGGGTTCCCGCAGGCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1033 |
LEAP-Seq percent confirming: | 98.3015 |
LEAP-Seq n confirming: | 463 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGACGGGTGAGATAAGGGAC |
Suggested primer 2: | GCATCATAATGTGACGACGG |