Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.213247 |
Chromosome: | chromosome 17 |
Location: | 3516749 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g725200 | (1 of 2) K05658 - ATP-binding cassette, subfamily B (MDR/TAP), member 1 (ABCB1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGTATGGATGGCCTCCAGGGCCCAGCCT |
Internal bar code: | ACTCGTTTCTCTTGTGTTACAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 621 |
LEAP-Seq percent confirming: | 98.3502 |
LEAP-Seq n confirming: | 2921 |
LEAP-Seq n nonconfirming: | 49 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGAGATCAAGGAGGAGTTGC |
Suggested primer 2: | CTTGGCATACCATCGTTGTG |