Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.213262 |
Chromosome: | chromosome 9 |
Location: | 2098024 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g393850 | MAPKKK2,PTK28,MAPKKK2 | Mitogen-Activated Protein Kinase Kinase Kinase; (1 of 1) IPR000719//IPR001229//IPR001245//IPR002290//IPR011009//IPR020635 - Protein kinase domain // Jacalin-like lectin domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGTCCCGCGGCCGCCTGTCCTCCGCCGC |
Internal bar code: | TGGACGTCACGTGACTGCGGTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 40 |
LEAP-Seq percent confirming: | 86.4765 |
LEAP-Seq n confirming: | 940 |
LEAP-Seq n nonconfirming: | 147 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGTTGATTTTCACATGCAC |
Suggested primer 2: | ACACAGGAGGGAACCAGATG |