| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.213311 |
| Chromosome: | chromosome 16 |
| Location: | 5776977 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g678450 | Glycosyl transferase; (1 of 2) PTHR10859//PTHR10859:SF50 - GLYCOSYL TRANSFERASE // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAAGGCACCAGCTGCAGAGTACGGTATACG |
| Internal bar code: | TTAATCGCCACTGGGACATACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 188 |
| LEAP-Seq percent confirming: | 99.8316 |
| LEAP-Seq n confirming: | 593 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACTGCATCTTCGCCTACA |
| Suggested primer 2: | GCGTCGAAGATACTGAAGGC |