| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.213347 |
| Chromosome: | chromosome 3 |
| Location: | 588120 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g145547 | CBR1 | (1 of 3) K00326 - cytochrome-b5 reductase (E1.6.2.2); NADH-cytochrome b5 reductase | gene_edge/mRNA_edge/5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGTGATTACAAATAGCAATTTGATGGTT |
| Internal bar code: | CGGGCTATCACCGCTTGGACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 579 |
| LEAP-Seq percent confirming: | 99.8755 |
| LEAP-Seq n confirming: | 1605 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCCTAGGCTTTGAGCGTGT |
| Suggested primer 2: | TGTGCGTGATTAGCGTCTTC |