| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.213430 |
| Chromosome: | chromosome 14 |
| Location: | 1323963 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g616900 | SULP2,SLP2 | Chloroplast sulfate permease; (1 of 1) K02047 - sulfate transport system permease protein (cysW) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCTGGTGGTGCTGGCGTTGCGAGGCCCT |
| Internal bar code: | CGTCGCAGAGACGGGGCGGACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1002 |
| LEAP-Seq percent confirming: | 84.8431 |
| LEAP-Seq n confirming: | 5704 |
| LEAP-Seq n nonconfirming: | 1019 |
| LEAP-Seq n unique pos: | 70 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTCATCGGCTACAGGCACT |
| Suggested primer 2: | ATGCGAACGGTGTATGTCAA |