Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.213516 |
Chromosome: | chromosome 11 |
Location: | 3465966 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g481126 | (1 of 1) PTHR19370:SF90 - NADH-CYTOCHROME B5 REDUCTASE 2 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCCCATATTCCCGCCCGCTGGTCGTAGT |
Internal bar code: | GGAGGACAGCAATCAGTGAGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 218 |
LEAP-Seq percent confirming: | 4.38001 |
LEAP-Seq n confirming: | 793 |
LEAP-Seq n nonconfirming: | 17312 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGTGTGTGTGTGTGTGTGT |
Suggested primer 2: | TCGGACACACACACACACAC |