| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.213566 |
| Chromosome: | chromosome 6 |
| Location: | 2523338 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g269200 | CYA7 | (1 of 2) 2.7.11.1//4.6.1.1 - Non-specific serine/threonine protein kinase / Threonine-specific protein kinase // Adenylate cyclase / ATP pyrophosphate-lyase; Adenylate cyclase | 3'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATCAGCGCCTATCCCACGTCTTTCCCTT |
| Internal bar code: | GCGGATGTGTGCATCCCGTTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1009 |
| LEAP-Seq percent confirming: | 99.6351 |
| LEAP-Seq n confirming: | 4915 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCATAACGATCTCCAACCA |
| Suggested primer 2: | GTTCAAAGTGACCTGCCCAT |