| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.213568 |
| Chromosome: | chromosome 10 |
| Location: | 586137 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g421700 | GPDH1,GPD4 | Glycerol-3-phosphate dehydrogenase/dihydroxyacetone-3-phosphate reductase; (1 of 4) 1.1.1.8 - Glycerol-3-phosphate dehydrogenase (NAD(+)) / NADH-dihydroxyacetone phosphate reductase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGTGTGCGCGCGCAAAGCGCGCGTTGTT |
| Internal bar code: | GATCACCTGTTGCCTCTAGAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 682 |
| LEAP-Seq percent confirming: | 99.5654 |
| LEAP-Seq n confirming: | 3207 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGTCCCCATTTTAGTGCGT |
| Suggested primer 2: | CCCAAGTACGTGGTGGAGTT |