| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.213614 |
| Chromosome: | chromosome 11 |
| Location: | 596924 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467610 | (1 of 3) PTHR10751//PTHR10751:SF2 - GUANYLATE BINDING PROTEIN // GUANYLATE-BINDING PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCATGGCAATCGCCGGCGAGAGGAGACTC |
| Internal bar code: | GCGGGTGAATGGCGACTACGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 239 |
| LEAP-Seq percent confirming: | 70.3406 |
| LEAP-Seq n confirming: | 1487 |
| LEAP-Seq n nonconfirming: | 627 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCTCACCACCCTCTGCTCTT |
| Suggested primer 2: | TTGCATAGCAGCCTGTCAAC |