Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.213657 |
Chromosome: | chromosome 11 |
Location: | 833685 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467647 | (1 of 1) K12179 - COP9 signalosome complex subunit 6 (COPS6, CSN6) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTTGCCAAAGAAGCAAAAAGGGCCCCGGC |
Internal bar code: | CGGGTCGGAGTGGGAACGCCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 857 |
LEAP-Seq percent confirming: | 99.7579 |
LEAP-Seq n confirming: | 412 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGTTTTGCAGATGTTGCTA |
Suggested primer 2: | GTCAATGTCTAGGGTGCCGT |