| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.213660 |
| Chromosome: | chromosome 14 |
| Location: | 2437247 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g624800 | ZF1 | (1 of 1) IPR011022//IPR014756 - Arrestin C-terminal-like domain // Immunoglobulin E-set; A zinc-finger containing stress-related regulator | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCTCGGGGAGGGCCCCTGACGCGCACGTG |
| Internal bar code: | CTTGTCGAATATTTGTTCTGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 184 |
| LEAP-Seq percent confirming: | 99.1718 |
| LEAP-Seq n confirming: | 1437 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGATATGTGGTTCATTTGCG |
| Suggested primer 2: | AGCTCGTTGATGAGGCAACT |