Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.213674 |
Chromosome: | chromosome 13 |
Location: | 3547076 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g588100 | CYN19C,ROC2,CYN5,CYN19-3 | (1 of 1) K09565 - peptidyl-prolyl isomerase F (cyclophilin D) (PPIF); Cyclophilin 19-3 | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAATGAAGGGTTCTGGAGAAATACACCGT |
Internal bar code: | GACGGTGTAGAGAGTAAGGTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 78 |
LEAP-Seq percent confirming: | 72.973 |
LEAP-Seq n confirming: | 27 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGAGAGATGACGCACTGAGG |
Suggested primer 2: | ACACGCAGCACCTTTATTCC |