| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.213792 |
| Chromosome: | chromosome 5 |
| Location: | 1755593 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g242550 | RSP6,PF26 | Radial spoke protein 6; (1 of 2) PF04712 - Radial spokehead-like protein (Radial_spoke) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGCCCTCTGTCCCTTCCCCCGATCGTGC |
| Internal bar code: | CTACGGCAAAAGGCGGCCGTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 404 |
| LEAP-Seq percent confirming: | 98.1982 |
| LEAP-Seq n confirming: | 109 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGTGTGTGTTACCGTGCTT |
| Suggested primer 2: | CGAAGAACTTGCCGAAGAAG |