Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.213808 |
Chromosome: | chromosome 8 |
Location: | 756827 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g360564 | ERM3 | (1 of 13) PTHR13018//PTHR13018:SF5 - PROBABLE MEMBRANE PROTEIN DUF221-RELATED // PHOSPHATE METABOLISM PROTEIN 7; ERD4-related membrane protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCACCCTGTGCCGCTGCCCTCACGGCTCT |
Internal bar code: | GACAGCCGGCCACGCATCGTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 194 |
LEAP-Seq percent confirming: | 30.122 |
LEAP-Seq n confirming: | 2889 |
LEAP-Seq n nonconfirming: | 6702 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCCAGGAAGATCTGAAGCAC |
Suggested primer 2: | CATTCCACTCTTCCTCTCGC |