| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.213811 |
| Chromosome: | chromosome 9 |
| Location: | 3054588 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g387250 | CSR3 | (1 of 3) K08106 - N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase (CHST15); Carbohydrate sulfotransferase-related 3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACCATCTTCCTGCCATCCTGTCGCCCGC |
| Internal bar code: | GCCGGACACTCGCGCCATGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 402 |
| LEAP-Seq percent confirming: | 95.627 |
| LEAP-Seq n confirming: | 1815 |
| LEAP-Seq n nonconfirming: | 83 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGTGTCCAAAAGCCTTGTC |
| Suggested primer 2: | CCGGGATCGTCAAGTACAGT |