Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.213879 |
Chromosome: | chromosome 12 |
Location: | 3345287 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g497450 | FAP412 | (1 of 21) IPR001611//IPR003591 - Leucine-rich repeat // Leucine-rich repeat, typical subtype; Flagellar Associated Protein 412 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGAGGGGGAGGGGAAGGGATATATGGTAT |
Internal bar code: | GACACAGGCCCGCGCGAAGGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 334 |
LEAP-Seq percent confirming: | 97.2763 |
LEAP-Seq n confirming: | 250 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACCAGCCCAAACTAAACCG |
Suggested primer 2: | CTTAGACCTGCATTCCCGAG |