| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.213929 |
| Chromosome: | chromosome 7 |
| Location: | 4806442 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g345750 | NAT20 | N-acetyltransferase; (1 of 3) IPR000182//IPR011011//IPR016181 - GNAT domain // Zinc finger, FYVE/PHD-type // Acyl-CoA N-acyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCAGTTCCTCGGGCTGGAAGCTGCTCTG |
| Internal bar code: | AAAACCTTCGTCGAACCCTCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 176 |
| LEAP-Seq percent confirming: | 99.6032 |
| LEAP-Seq n confirming: | 502 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGGGCGCAGTCGAAGTAG |
| Suggested primer 2: | CAGCTTTCCCCTTATCTCCC |