| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.213929 |
| Chromosome: | chromosome 11 |
| Location: | 567246 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467608 | (1 of 4) IPR003882//IPR008752 - Pistil-specific extensin-like protein // Peptidase M11, gametolysin | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGCGTGATGGGATGGGGTTTTGGAGAGG |
| Internal bar code: | CACACCTAGTCTTTATACAAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 241 |
| LEAP-Seq percent confirming: | 98.6864 |
| LEAP-Seq n confirming: | 601 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCTACCTGTGCCTCAACTC |
| Suggested primer 2: | TGTCATACACACACGCCCTT |