| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.213992 |
| Chromosome: | chromosome 12 |
| Location: | 3385847 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g497000 | FAP14 | Flagellar Associated Protein 14; (1 of 1) K15426 - serine/threonine-protein phosphatase 4 regulatory subunit 4 (PPP4R4) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGACAGACCGGGAGCAAGGCGCAGTAAGGG |
| Internal bar code: | GCAACTGGGAGGGCCTCCACCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 327 |
| LEAP-Seq percent confirming: | 97.4898 |
| LEAP-Seq n confirming: | 1670 |
| LEAP-Seq n nonconfirming: | 43 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCTCGCCCTTGATCCTGT |
| Suggested primer 2: | GCTTTTCATCGCGCTTTATC |