Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.214044 |
Chromosome: | chromosome 10 |
Location: | 1618584 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g429601 | (1 of 2) PTHR10060:SF22 - CELL DEATH-RELATED NUCLEASE 2 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGATGGGGTTCGGGCGGCGGGAGGTTGT |
Internal bar code: | CGGGAGTTACTAGGGCCCGGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 252 |
LEAP-Seq percent confirming: | 97.0637 |
LEAP-Seq n confirming: | 1752 |
LEAP-Seq n nonconfirming: | 53 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAACCAACCCCAATGCAATA |
Suggested primer 2: | TGACGAGCACTATCACTCCG |