| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.214058 |
| Chromosome: | chromosome 11 |
| Location: | 331284 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467567 | UBQ1 | Ubiquitin; (1 of 1) PTHR10666:SF150 - POLYUBIQUITIN 3 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCGGCGCTTGTCAAGATGCAGATTTTCG |
| Internal bar code: | ACAGGGCTCAGCTACGGGGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 631 |
| LEAP-Seq percent confirming: | 99.6703 |
| LEAP-Seq n confirming: | 907 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCGGATTCCGTGATCTTGT |
| Suggested primer 2: | CCATTAAGGCGGTGAGAAAA |