| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.214087 |
| Chromosome: | chromosome 3 |
| Location: | 8044624 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g201400 | PPP16,PP2C6 | Phosphoprotein phosphatase 2C-related; (1 of 70) 3.1.3.16 - Protein-serine/threonine phosphatase / Serine/threonine specific protein phosphatase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTACAAACACCCATCATCACAACGCATTC |
| Internal bar code: | GCCGGGGGCCGCGAAGGTGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 776 |
| LEAP-Seq percent confirming: | 95.4178 |
| LEAP-Seq n confirming: | 354 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAAGAGCACTGCCTTTGCC |
| Suggested primer 2: | ATACAGAACCGCACCACCTC |