| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.214117 |
| Chromosome: | chromosome 1 |
| Location: | 5536863 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g039250 | RPS2 | Cytosolic 80S ribosomal protein S2; (1 of 1) K02981 - small subunit ribosomal protein S2e (RP-S2e, RPS2) | 3'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGGTCCGGACGCGTCCACTGGGGTTCAA |
| Internal bar code: | CTATAGTGCCGTCCTGCTGCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 751 |
| LEAP-Seq percent confirming: | 99.5811 |
| LEAP-Seq n confirming: | 2615 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAATTTTCAAGGCGGATCA |
| Suggested primer 2: | GTGCCTACGAGAGGCTTTTG |