| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.214158 |
| Chromosome: | chromosome 4 |
| Location: | 110905 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g216700 | PHOX,PHO5 | Phosphate-repressible alkaline phosphatase; (1 of 2) 3.1.3.1 - Alkaline phosphatase / Phosphomonoesterase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTGGCCGCTGCTGTCCTCGGCAATGAAC |
| Internal bar code: | GCACACGCGCACACGTGTTTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 312 |
| LEAP-Seq percent confirming: | 97.3513 |
| LEAP-Seq n confirming: | 1801 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCTGCTCTTGTGGTGTTGC |
| Suggested primer 2: | GCTGAACAGGTAGGAGTCGC |