Insertion junction: LMJ.RY0402.214163_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.214163
Chromosome:chromosome_12
Location:222111
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre12.g485000 FAP182 Flagellar Associated Protein antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):ATGCGGCGGGAACCCCACGTGCCCGCAACT
Internal bar code:CGCCCGGTGTAAATACGTCCG

Confirmation - LEAP-Seq

LEAP-Seq distance:733
LEAP-Seq percent confirming:99.5527
LEAP-Seq n confirming:3561
LEAP-Seq n nonconfirming:16
LEAP-Seq n unique pos:13

Suggested primers for confirmation by PCR

Suggested primer 1:TGTAGGTGAGCGTGTCCTTG
Suggested primer 2:AACCGCGTAGATATGGTTGC