Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.214196 |
Chromosome: | chromosome 3 |
Location: | 8490207 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g200655 | DEG4 | (1 of 1) 3.2.1.55 - Non-reducing end alpha-L-arabinofuranosidase / Arabinosidase; DegP protease and Glycoside hydrolase family 3 protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGTGCCTCCTTCAGGAGGCAAGCAGCGC |
Internal bar code: | TATCTTTTGTTTCGTCACCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 659 |
LEAP-Seq percent confirming: | 98.915 |
LEAP-Seq n confirming: | 547 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTGGTTTAGTTTGGGCTGG |
Suggested primer 2: | GTTGTGTGACGTGCTGTGG |