Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.214317 |
Chromosome: | chromosome 10 |
Location: | 3207362 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g442650 | (1 of 1) PTHR10887:SF366 - DNA-BINDING PROTEIN-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAATTTGGCGGGCAGCTCCTTCGCCTTCGC |
Internal bar code: | TGAGCACTAAACGTTGCATCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 369 |
LEAP-Seq percent confirming: | 99.5526 |
LEAP-Seq n confirming: | 445 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTTGGCCAGTTTCTCTAGC |
Suggested primer 2: | ATGACCGGTAGTATGGCTGC |