Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.214439 |
Chromosome: | chromosome 12 |
Location: | 7005972 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g559850 | (1 of 1) K12880 - THO complex subunit 3 (THOC3) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTGTCTATGTGTTCTATCGGCTTCCTCG |
Internal bar code: | GCGACGTAGCGAATACGACGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 729 |
LEAP-Seq percent confirming: | 98.8026 |
LEAP-Seq n confirming: | 5116 |
LEAP-Seq n nonconfirming: | 62 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCATACCGTATCAAGGCAA |
Suggested primer 2: | TTCTGAAAGCAGAAGGGGAA |