| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.214486 |
| Chromosome: | chromosome 12 |
| Location: | 2545855 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g505750 | RPB9 | DNA-directed RNA polymerase II, 14.5 kDa polypeptide; (1 of 1) K03017 - DNA-directed RNA polymerase II subunit RPB9 (RPB9, POLR2I) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCAAGAATGCTCATGCAATTTTCGGACCG |
| Internal bar code: | GGATACTCTCCTGGAGATGCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 356 |
| LEAP-Seq percent confirming: | 99.6456 |
| LEAP-Seq n confirming: | 16870 |
| LEAP-Seq n nonconfirming: | 60 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGCAGGTGTAGCTGATGTG |
| Suggested primer 2: | CCACTGTCATACATGGCGTC |