Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.214491 |
Chromosome: | chromosome 17 |
Location: | 3007715 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g720400 | HMA1 | (1 of 1) PTHR24093:SF272 - CADMIUM/ZINC-TRANSPORTING ATPASE HMA1, CHLOROPLASTIC-RELATED; heavy metal transporting ATPase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGCCCTAGAGGCTTGTAGTTATAGGACT |
Internal bar code: | TAGGTCGTAAGTCCCCGAAGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 220 |
LEAP-Seq percent confirming: | 95.6332 |
LEAP-Seq n confirming: | 219 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTAACACCCCTCATCTCGT |
Suggested primer 2: | TGTGCACAGAAATTGGTGGT |