Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.214607 |
Chromosome: | chromosome 12 |
Location: | 3227600 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g498700 | CPLD13 | Conserved in the Plant Lineage and Diatoms | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGTCCGACAAGCTCGTTAGGGCGGCTGT |
Internal bar code: | GGCTTTGAGGGATTTGGGAGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1059 |
LEAP-Seq percent confirming: | 99.8022 |
LEAP-Seq n confirming: | 7567 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAACACGACCTGGTCCAACT |
Suggested primer 2: | ATGTTGCTGTGTTTGGTGGA |