| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.214617 |
| Chromosome: | chromosome 15 |
| Location: | 467611 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g636600 | FAP391 | (1 of 8) PF00560 - Leucine Rich Repeat (LRR_1); Flagellar Associated Leucine Rich Repeat Protein 391 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGTATGTGAGGAGTCTGTGAGGAGGCAG |
| Internal bar code: | CCAACGGCGTACTTTTACTCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 344 |
| LEAP-Seq percent confirming: | 99.5016 |
| LEAP-Seq n confirming: | 13177 |
| LEAP-Seq n nonconfirming: | 66 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCAGACTGTGGAGCAGATG |
| Suggested primer 2: | GCCCTCCGATCAAAGTACAA |