| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.214663 |
| Chromosome: | chromosome 13 |
| Location: | 3439408 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g587450 | FCL2 | Predicted 5-formyltetrahydrofolate cycloligase; (1 of 1) PTHR13017:SF0 - METHENYLTETRAHYDROFOLATE SYNTHASE DOMAIN-CONTAINING PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCGGATCGAGCGCGAGACCGGCACGCCG |
| Internal bar code: | ATAGATCGTAGGTAACTCATAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 252 |
| LEAP-Seq percent confirming: | 97.2264 |
| LEAP-Seq n confirming: | 3856 |
| LEAP-Seq n nonconfirming: | 110 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTGGATCTCATCGTGGTC |
| Suggested primer 2: | GTCCATGACCCTTCACGACT |