| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.214677 |
| Chromosome: | chromosome 17 |
| Location: | 3850925 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g728100 | (1 of 1) 3.5.1.14 - N-acyl-aliphatic-L-amino acid amidohydrolase / N-acyl-L-amino-acid amidohydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTGGTGACCATCAAAAGAAGTGTCGATT |
| Internal bar code: | TCTCCCGTGTAGCTAAAGCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 633 |
| LEAP-Seq percent confirming: | 99.5867 |
| LEAP-Seq n confirming: | 13733 |
| LEAP-Seq n nonconfirming: | 57 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTGAGCCTCGACAACTTT |
| Suggested primer 2: | CAAGACTCAAGCCTGGGAAG |