| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.214695 |
| Chromosome: | chromosome 11 |
| Location: | 3718368 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g482841 | (1 of 2) K11145 - ribonuclease III family protein [EC:3.1.26.-] (K11145) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAAGTTAACATGTCTTCTGCATCTCACAT |
| Internal bar code: | CGCCTACTCGATGGTGTGCTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 895 |
| LEAP-Seq percent confirming: | 98.338 |
| LEAP-Seq n confirming: | 355 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGGACTGTTACCACGGAA |
| Suggested primer 2: | AATGATATGACGCTCTCGGG |