| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.214714 |
| Chromosome: | chromosome 16 |
| Location: | 653926 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g691800 | FLVB1,FLVB | (1 of 2) 1.5.3.22 - Coenzyme F420H(2) oxidase; Thylakoid flavodiiron protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTACCCTTGCAACCCCACGCTCCCCACG |
| Internal bar code: | AAGATACGCGGAATGACTAAGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 553 |
| LEAP-Seq percent confirming: | 98.6336 |
| LEAP-Seq n confirming: | 5775 |
| LEAP-Seq n nonconfirming: | 80 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTAGGTGACCCAGTGGTCG |
| Suggested primer 2: | TTGTTGTTGTGTGGCATGTG |