| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.214766 |
| Chromosome: | chromosome 2 |
| Location: | 7665022 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g143200 | TSA1 | Alanyl-tRNA-synthetase; (1 of 1) PTHR11777//PTHR11777:SF18 - ALANYL-TRNA SYNTHETASE // ALANINE--TRNA LIGASE, CYTOPLASMIC | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATCAGGAGGAGGGTTTGAGACGCGGCGC |
| Internal bar code: | CGCAAATTCGATGAACACCTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 405 |
| LEAP-Seq percent confirming: | 93.5897 |
| LEAP-Seq n confirming: | 2336 |
| LEAP-Seq n nonconfirming: | 160 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAAAGGTGTTTCGACCCAA |
| Suggested primer 2: | CCTTGGTCTCGAAGAACTCG |