Insertion junction: LMJ.RY0402.214779_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.214779
Chromosome:chromosome_4
Location:332587
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre04.g217908 FAP79 Flagellar Associated Protein antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):GGACGAGCGTAGTGGATTATAGGGGTGTGT
Internal bar code:AGGGCGCATGTTCAGCGGGGGA

Confirmation - LEAP-Seq

LEAP-Seq distance:1010
LEAP-Seq percent confirming:98.5163
LEAP-Seq n confirming:4847
LEAP-Seq n nonconfirming:73
LEAP-Seq n unique pos:25

Suggested primers for confirmation by PCR

Suggested primer 1:CCTGTTGGCAGTCATACCCT
Suggested primer 2:ACTGACCATGCCATACGTGA