Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.214804 |
Chromosome: | chromosome 1 |
Location: | 7093449 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g051211 | MAE9 | (1 of 11) K03327 - multidrug resistance protein, MATE family (TC.MATE, SLC47A, norM, mdtK, dinF); MATE efflux family protein | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCCGGCATTAGGTGGCGACTGGAAGAG |
Internal bar code: | GTTGGTGACTAGCACTCGCAAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 884 |
LEAP-Seq percent confirming: | 99.3344 |
LEAP-Seq n confirming: | 2537 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAACTCAGCTCTTCCATCC |
Suggested primer 2: | CCTGTTCTAGGCGCAAACTC |