| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.214824 |
| Chromosome: | chromosome 1 |
| Location: | 5419562 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g038050 | COP7,HKR3,COP | Histidine kinase rhodopsin 3; (1 of 1) PF00072//PF00512//PF01036 - Response regulator receiver domain (Response_reg) // His Kinase A (phospho-acceptor) domain (HisKA) // Bacteriorhodopsin-like protein (Bac_rhodopsin) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTAGCCCAAAAAGTTTGTGTGGCCGTAGG |
| Internal bar code: | CCTCATACCGATGCAAGGTTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 134 |
| LEAP-Seq percent confirming: | 94.7368 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTAGCAATGGAGTCACTG |
| Suggested primer 2: | TACCCTACCTGCCTCACACC |