| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.214825 |
| Chromosome: | chromosome 11 |
| Location: | 2062542 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g468700 | CPLD65,HCAR1 | 7-hydroxymethyl chlorophyll a reductase; (1 of 1) 1.17.7.2 - 7-hydroxymethyl chlorophyll a reductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGAGATCAAGGACGCCTGGCCAATCTTGA |
| Internal bar code: | CAGGGGGCCGGACGACAGACCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 604 |
| LEAP-Seq percent confirming: | 99.8698 |
| LEAP-Seq n confirming: | 1534 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTCCCAACACAAGTTCCAT |
| Suggested primer 2: | GTACGGCACACACCTTGATG |