| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.214841 |
| Chromosome: | chromosome 3 |
| Location: | 5530211 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g186100 | (1 of 13) IPR005123//IPR006620 - Oxoglutarate/iron-dependent dioxygenase // Prolyl 4-hydroxylase, alpha subunit | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGATGGTGTGTGGCGCCGGCATCCTGGCGG |
| Internal bar code: | ACGGTTTGCCCGGGAGTCCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1057 |
| LEAP-Seq percent confirming: | 94.356 |
| LEAP-Seq n confirming: | 13391 |
| LEAP-Seq n nonconfirming: | 801 |
| LEAP-Seq n unique pos: | 74 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACACATCTCCCCAAACTT |
| Suggested primer 2: | TGAGAACTGGGGATCAGGAC |