| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.214879 |
| Chromosome: | chromosome 6 |
| Location: | 2019370 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g264250 | FAO6 | FAD-dependent oxidoreductase; (1 of 3) 5.5.1.19 - Lycopene beta-cyclase | CDS/intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGATCGCCACGCACGCCTCCAGCTCCTC |
| Internal bar code: | ACGTTAAGGTAATGTATGGTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 849 |
| LEAP-Seq percent confirming: | 96.8448 |
| LEAP-Seq n confirming: | 7520 |
| LEAP-Seq n nonconfirming: | 245 |
| LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATTCCAAACACACACCTG |
| Suggested primer 2: | GATGAAGCTCTAAGGCGGTG |