| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.214946 |
| Chromosome: | chromosome 3 |
| Location: | 3701871 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g169350 | (1 of 3) IPR007860 - DNA mismatch repair protein MutS, connector domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCGGGTGTACGGGTTGCGGGCAATCGGC |
| Internal bar code: | CGCCGTCCCCTGAACTAGGATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 870 |
| LEAP-Seq percent confirming: | 84.8183 |
| LEAP-Seq n confirming: | 5369 |
| LEAP-Seq n nonconfirming: | 961 |
| LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGATGTTGGTGCGAGCTTAG |
| Suggested primer 2: | TGACTGTCCTGAGGCAACTG |