| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.214963 |
| Chromosome: | chromosome 3 |
| Location: | 7971869 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g201950 | (1 of 1) IPR003882//IPR008752//IPR024079 - Pistil-specific extensin-like protein // Peptidase M11, gametolysin // Metallopeptidase, catalytic domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAAACATACATAGACAGATACATAGGCGC |
| Internal bar code: | GCGGGTATAGTATCGCTTCCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1101 |
| LEAP-Seq percent confirming: | 98.2564 |
| LEAP-Seq n confirming: | 2705 |
| LEAP-Seq n nonconfirming: | 48 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCTGACACAGACCGCATC |
| Suggested primer 2: | CCTCTGCAGTCCTCCAACTC |