| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.214984 |
| Chromosome: | chromosome 16 |
| Location: | 892386 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g648200 | CYP744C1,CYP35 | (1 of 3) K01832 - thromboxane-A synthase (TBXAS1, CYP5A); Cytochrome P450, CYP3 superfamily | intron|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTACGCAGCATGAAAACTTACGCAGTCGCA |
| Internal bar code: | ATGAAAACCCGTGCGTGGCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 978 |
| LEAP-Seq percent confirming: | 99.433 |
| LEAP-Seq n confirming: | 3683 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGCTGCTCTTAAACCCAC |
| Suggested primer 2: | CTGGTCCACTTCTGTCACGA |