| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.215006 |
| Chromosome: | chromosome 14 |
| Location: | 3707764 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g631900 | (1 of 1) K14648 - poly(U)-specific endoribonuclease (ENDOU, PP11); Similar to Putative Serine Protease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGACACAATGTTCCGCAGAGCGGCAAGTC |
| Internal bar code: | ATGACTTCAAACGAGCAAGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 996 |
| LEAP-Seq percent confirming: | 99.5397 |
| LEAP-Seq n confirming: | 3676 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGTCAGTGGGGGTCTAAAT |
| Suggested primer 2: | CGCTCGTAATTGTCAAGCAA |