| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.215100 |
| Chromosome: | chromosome 10 |
| Location: | 4288920 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g450650 | (1 of 34) PF00168 - C2 domain (C2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGGCCGTGACATGAGGGTCTGGCATGGA |
| Internal bar code: | GTTGTGGGCCCGTTTCAGGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 947 |
| LEAP-Seq percent confirming: | 99.622 |
| LEAP-Seq n confirming: | 42429 |
| LEAP-Seq n nonconfirming: | 161 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTACAAGGCCAAGAGCAAG |
| Suggested primer 2: | TGTGATATTGCTAGGCAGCG |